View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15024_low_57 (Length: 242)
Name: NF15024_low_57
Description: NF15024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15024_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 225
Target Start/End: Original strand, 4881100 - 4881309
Alignment:
| Q |
16 |
atgaagcaaataccatgtaacacttatatttaaacatcttgtacgtctaaaagagcaagggaatggaaaccttatctttatttttctattaattagtcaa |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4881100 |
atgaagcaaataccatgcaacacttatatttaaacatcttgtacgtctaaaagagcaagggaatggaaaccttatctttatttttctattaattagtcaa |
4881199 |
T |
 |
| Q |
116 |
taaaaattcaaaaagggtctctagnnnnnnnacaggaacattatctagtttttaaaaaatatacatgattttattctctctattctcctgaaataaagtt |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4881200 |
taaaaattcaaaaagggtctctagtttttttacaggaacattatctagtttttaaaaaatatacatgattttattctctctattttcctgaaataaagtt |
4881299 |
T |
 |
| Q |
216 |
taagtatata |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
4881300 |
taagtatata |
4881309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University