View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15024_low_67 (Length: 202)
Name: NF15024_low_67
Description: NF15024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15024_low_67 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 49 - 194
Target Start/End: Original strand, 34994891 - 34995036
Alignment:
| Q |
49 |
taaatgattgggaaaatttgtctcgttcatagcatgattcgcttgtctatactgaaaaatctgcatgtgttggcattggttgatcgtcgagtaatatttg |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34994891 |
taaatgattgggaaaatttgtctcgttcatagcatgattcgcttgtctatactgaaaaatctgcatgtgttagcattggttgatcgtcgagtaatatttg |
34994990 |
T |
|
| Q |
149 |
tcaaaattgcaaaaagtgtgtctcaaatacaccttcttttcactcg |
194 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34994991 |
tgaaaattgcaaaaagtgtgtctcaaatacaccttcttttaactcg |
34995036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University