View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15025_high_14 (Length: 451)
Name: NF15025_high_14
Description: NF15025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15025_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 407; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 407; E-Value: 0
Query Start/End: Original strand, 16 - 434
Target Start/End: Complemental strand, 52787647 - 52787229
Alignment:
| Q |
16 |
atgaaaccgagtaagattcatttgtttgtgtacggtcttttgtttggtttggctgacacgtgggcagcgatgcctgataacaaaatggtcggaaaagcaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52787647 |
atgaaaccgagtaagattcatttgtttgtgtacggtcttttgtttggtttggctgacacgtgggcagcgatgcctgataacaaaatggtcggaaaagcaa |
52787548 |
T |
 |
| Q |
116 |
ttagggatccaaataagttgaagattattgcttctaatccaaggaggtatacgggcccacctagagtagggaccatgagggaacttcttagagtcactca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52787547 |
ttagggatccaaataagttgaagattattgcttctaatccaaggaggtatacgggcccacctagagtagggaccatgagggaacttcttagagtcactca |
52787448 |
T |
 |
| Q |
216 |
atatgtgcaagataatttctgcaatgtaacggtgccgtttcttacggcacatggtactgctgatggtgtcacgtgcccttcttcttctaagctgttgtat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52787447 |
atatgtgcaagataatttctgcaatgtaacggtgccgtttcttacggcacatggtactgctgatggtgtcacgtgcccttcttcttctaagctgttgtat |
52787348 |
T |
 |
| Q |
316 |
gagaaagccgaatccaaggataagactttgaagctttatgatgggatgtatcattctttgattcaaggggagcctgatgagtctgctaatcttgtgttaa |
415 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52787347 |
gagaaagctgaatctaaggataagactttgaagctttatgaggggatgtatcattctttgattcaaggggagcctgatgagtctgctaatcttgtgttaa |
52787248 |
T |
 |
| Q |
416 |
gggatatgagggagtggat |
434 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
52787247 |
gggatatgagggagtggat |
52787229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University