View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15025_high_42 (Length: 297)
Name: NF15025_high_42
Description: NF15025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15025_high_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 45366619 - 45366338
Alignment:
| Q |
1 |
gagggaatttagtgggtggaggtggaaatttctctggcaaaagaggt-tgtgtgagtgagaggcgggggtattgacgacgttgcctcaccaagtttgtta |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
45366619 |
gagggaatttagtgggtggaggtggaaatttctctggcaaaagaggtgtgtgtgagtgagaggcggggttattgacgacgttgcctcgccaagtttgtta |
45366520 |
T |
|
| Q |
100 |
atgaaggaagatttgtgggtctgcactactctatagtgaaggttctttctaggttaaaccggcatattcttttttagttacattacattgacgctgaacg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45366519 |
atgaaggaagatttgtgggtctgcactactctatagtgaaggttctttctaggttaaaccggcatattcttttttagttacattacattgacgctgaacg |
45366420 |
T |
|
| Q |
200 |
aggtcaatcttgcctttttggaggcttttgtgtttcgaagtatatggaaaagcccaacagcttccaaggcagtggtcttttt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45366419 |
aggtcaatcttgcctttttggaggcttttgtgtttcgaagtatatggaaaagcccaacagcttccaaggcagtggtcttttt |
45366338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University