View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15025_high_49 (Length: 269)
Name: NF15025_high_49
Description: NF15025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15025_high_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 68
Target Start/End: Original strand, 10342899 - 10342956
Alignment:
| Q |
15 |
atcaaaatcaaaggtagtgct----cttgtttattttcacttcctttataaaaatcaa |
68 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10342899 |
atcaaaatcaaaggtagtgctagctcttgtttattttcacttcctttataaaaatcaa |
10342956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 160 - 206
Target Start/End: Original strand, 41729548 - 41729594
Alignment:
| Q |
160 |
atttattccaaatctattcttgcacgtttatatggttatttacagcc |
206 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41729548 |
atttattcccaatctatccttgcacgtttatatggttatttacagcc |
41729594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 249
Target Start/End: Original strand, 41729849 - 41729893
Alignment:
| Q |
205 |
ccatggaagatgtgtgctcaattattcaagatgttacaccaacaa |
249 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41729849 |
ccatagaagatgtgtgctcaattattcaaactgttacaccaacaa |
41729893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University