View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15025_low_26 (Length: 390)
Name: NF15025_low_26
Description: NF15025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15025_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 7e-65; HSPs: 10)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 251 - 376
Target Start/End: Complemental strand, 37002207 - 37002082
Alignment:
| Q |
251 |
agtagtataatggtttgttcttcttgatccttttcatctccgtttcattgcatgctaatcaacactacccttcttttatttccttcatttctttctaggc |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37002207 |
agtagtataatggtttgttcttcttgatccttttcatctccgtttcattgcatgctaatcaacactacccttcttttatttccttcatttctttctaggc |
37002108 |
T |
 |
| Q |
351 |
ctcttcttgctctggtgtatcctatg |
376 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
37002107 |
ctcttcttgctctggtgtatcctatg |
37002082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 37002653 - 37002520
Alignment:
| Q |
1 |
tacttattctaatacagcagccattgaatgtttgaaataa-tttgattcctcttctctttctctatcacatggcttcttcatggtttcttaaactggctt |
99 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37002653 |
tacttattctaatacaacagccattgaatgtttgaaataaatttgattcctcttctct------atcacatggcttcttcatggtttcttaaactggctt |
37002560 |
T |
 |
| Q |
100 |
tcaaatgccttcatcattttgcatggtatgtatatccctc |
139 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37002559 |
tcaaatggcttcatcattttgcatggtatgtatatccctc |
37002520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 184 - 259
Target Start/End: Complemental strand, 37002475 - 37002400
Alignment:
| Q |
184 |
gaaaaaataaatacacttatgttttctcatatatcttcacattatcagtttcatgtataaactacaaagtagtata |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37002475 |
gaaaaaataaatacacttatgttttctcatatatcttcacattatcagtttcatgtataaactacaaagtagtata |
37002400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 69 - 129
Target Start/End: Complemental strand, 36982898 - 36982838
Alignment:
| Q |
69 |
atggcttcttcatggtttcttaaactggctttcaaatgccttcatcattttgcatggtatg |
129 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
36982898 |
atggcttcttcatggtttctcaaactaactttcaaatgcctttatcattttgcatggtatg |
36982838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 69 - 129
Target Start/End: Complemental strand, 36998363 - 36998303
Alignment:
| Q |
69 |
atggcttcttcatggtttcttaaactggctttcaaatgccttcatcattttgcatggtatg |
129 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
36998363 |
atggcttcttcatggcttctcaaacttgctttcaaatgcattcatcattttgcatggtatg |
36998303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 299 - 376
Target Start/End: Complemental strand, 36998254 - 36998179
Alignment:
| Q |
299 |
tgcatgctaatcaacactacccttcttttatttccttcatttctttctaggcctcttcttgctctggtgtatcctatg |
376 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| | ||| |||||| ||| |||||||||||||||||||| |
|
|
| T |
36998254 |
tgcatgctaatcaacgttacccttcttttatttccttc--tattttataggccacttgttgctctggtgtatcctatg |
36998179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 376
Target Start/End: Complemental strand, 36982783 - 36982711
Alignment:
| Q |
302 |
atgctaatcaacactacccttcttttatttccttcatttctttctaggcctcttcttgctctggtgtatcctatg |
376 |
Q |
| |
|
||||| ||||| | |||||||||||||||||| || || ||||||||||||| |||||||||||||||||||| |
|
|
| T |
36982783 |
atgctgatcaatagtacccttcttttatttccctctctt--ttctaggcctcttgttgctctggtgtatcctatg |
36982711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 345 - 376
Target Start/End: Complemental strand, 36989230 - 36989199
Alignment:
| Q |
345 |
ctaggcctcttcttgctctggtgtatcctatg |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36989230 |
ctaggcctcttcttgctctggtgtatcctatg |
36989199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 249 - 278
Target Start/End: Complemental strand, 36989273 - 36989244
Alignment:
| Q |
249 |
aaagtagtataatggtttgttcttcttgat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36989273 |
aaagtagtataatggtttgttcttcttgat |
36989244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 65 - 129
Target Start/End: Complemental strand, 36989384 - 36989320
Alignment:
| Q |
65 |
tcacatggcttcttcatggtttcttaaactggctttcaaatgccttcatcattttgcatggtatg |
129 |
Q |
| |
|
||||||||||||||||| || || ||||| | |||||||| ||||||||| || |||||||||| |
|
|
| T |
36989384 |
tcacatggcttcttcattcttgctcaaactcgttttcaaatcccttcatcacttcgcatggtatg |
36989320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University