View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15025_low_31 (Length: 359)
Name: NF15025_low_31
Description: NF15025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15025_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 1 - 341
Target Start/End: Complemental strand, 47735944 - 47735603
Alignment:
| Q |
1 |
ataaataaattaagttaccaacggaaattatggaccgaaaaaa-tgatatatgtaacacttagcaacgaaattatgaacggatttcatttttagtactga |
99 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47735944 |
ataaataaattgagttaccaacggaaattatggaccgaaaaaaatgatatatgtaacacttagcaacgaaattatgaacggatttcatttttagtactga |
47735845 |
T |
|
| Q |
100 |
caatgtaagaatttgcagggaacggcgttactctttgatttaaaccatcaattaccattgacaatggaagttgaatccttggaatttgttatagcaaggt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47735844 |
caatgtaagaatttgcagggaacggcgttactctttgatttaaaccatcaattaccattgacaatggaagttgaatccttggaatttgttatagcaaggt |
47735745 |
T |
|
| Q |
200 |
ggccattctttgtcttcttaggtggttcaatgttctgtctcctctctagcagcatttgtcacctattttcatgtcactcccatgacttaaacctgtttct |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47735744 |
ggccattctttgtcttcttaggtggttcaatgttctgtctcctctctagcagcatttgtcacctattttcatgtcactcccatgacttaaacctgtttct |
47735645 |
T |
|
| Q |
300 |
gttaagaatagattatgtcggaatcgctgtcatgatcataac |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47735644 |
gttaagaatagattatgtcggaatcgctgtcatgatcataac |
47735603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University