View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15025_low_32 (Length: 356)
Name: NF15025_low_32
Description: NF15025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15025_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 73 - 203
Target Start/End: Original strand, 35702637 - 35702767
Alignment:
| Q |
73 |
aacgccgtcgtatcagcattatgaaccctaatcaaattacttgtagattatgctttattgtaatttgaattttgtggatttaattatgggtttgatcttg |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
35702637 |
aacgccgtcgtatcagcattatgaaccctaatcaaattacttgtagattatgctttattgtaatttgagttttgtggatttcattatgggtttgatcttg |
35702736 |
T |
 |
| Q |
173 |
aacaactcatgaaagataaagtcccaaaatt |
203 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |
|
|
| T |
35702737 |
aacaactcatgaaagataaagttccaaaatt |
35702767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 273 - 346
Target Start/End: Original strand, 35702824 - 35702897
Alignment:
| Q |
273 |
gtcttagcagtaataatctgttttgaggttattacactannnnnnnatgttattttttatgttaacagtctgtg |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||| |
|
|
| T |
35702824 |
gtcttagcagtaataatctgttttgaggttattacgctatttttttatgttatttttcatgttaacagtctgtg |
35702897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University