View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15025_low_44 (Length: 296)
Name: NF15025_low_44
Description: NF15025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15025_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 23 - 279
Target Start/End: Original strand, 6089348 - 6089604
Alignment:
| Q |
23 |
taaatcatagatccatatctttgtagattcaactccaaaggtaaattactactaacacttttatttgatgaaagtgacaaagacaaaggttcatgattat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6089348 |
taaatcatagatccatatctttgtagattcaactccaaaggtaaattactactaacacttttatttgatgaaagtgacaaagacaaaggttcatgattat |
6089447 |
T |
 |
| Q |
123 |
tcaacatcatagtacttgtactactatgttgttcatcaaattgtctaagattttgaatgttttgtgcttgataaagaaaagggttattattatttccttg |
222 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6089448 |
tcaacatcatagtactagtactactatgttgttcatcaaattgtctaagattttgaatgttttgtgcttgataaagaaaagggttattattatttccttg |
6089547 |
T |
 |
| Q |
223 |
attgttattcaaagtctcaaaataaggattagaagaagaaatattcatgaccctttt |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6089548 |
attgttattcaaagtctcaaaataaggattagaagaagaaatattcatgaccctttt |
6089604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University