View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15025_low_57 (Length: 239)
Name: NF15025_low_57
Description: NF15025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15025_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 44889670 - 44889554
Alignment:
| Q |
107 |
ggttgctgacatcaaattataaaaacagttttgcagatcttctagtagccaaaaagcaaaagtaaccacaaatggaattagtaagaactgcaagattata |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44889670 |
ggttgctgacatcaaattataaaaacagttttgcagatcttctagtagccaaaaagcaaaagtaaccacaaatggaattagtaagaactgcaagattata |
44889571 |
T |
 |
| Q |
207 |
cgatgcaggtagcgatt |
223 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
44889570 |
tgatggaggtagcgatt |
44889554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 44889777 - 44889741
Alignment:
| Q |
1 |
ataaaacgaagaattcgtgaatttatatcttaacttt |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44889777 |
ataaaacgaagaattcgtgaatttatatcttaacttt |
44889741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 143
Target Start/End: Complemental strand, 35143543 - 35143509
Alignment:
| Q |
109 |
ttgctgacatcaaattataaaaacagttttgcaga |
143 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35143543 |
ttgctgacagcaaattataaaaacagttttgcaga |
35143509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University