View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15025_low_67 (Length: 205)
Name: NF15025_low_67
Description: NF15025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15025_low_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 20 - 183
Target Start/End: Original strand, 33968464 - 33968627
Alignment:
| Q |
20 |
ttgttcattgcagattttgatgggtgaatctctattccnnnnnnnncgattgtttggatgaatctatttctccttgagaaaggttttgaatgggaatctt |
119 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33968464 |
ttgttcatcgcagattttgatgggtgaatctctattccttttttttcgattgtttggatgaatctatttctccttgagaaaggttttgaataggaatctt |
33968563 |
T |
|
| Q |
120 |
gtgtgaattaacaagatattattcaactgataaaaaaagcttctcttttcttaaataatgtcat |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33968564 |
gtgtgaattaacaagatattattcaactgataaaaaaagcttctcttttcttaaataatgtcat |
33968627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University