View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15026_high_24 (Length: 229)
Name: NF15026_high_24
Description: NF15026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15026_high_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 221
Target Start/End: Original strand, 37699408 - 37699612
Alignment:
| Q |
17 |
tgatggaactgtttgaaacataatgtgtgtgtagtgcaccatttataatgctttcatgggttcgagagtgtaacaatttcacctatgcgtgaatgtgttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
37699408 |
tgatggaactgtttgaaacataatgtgtgtgtagtgcaccatttataatgctttcatgggttcgcgagtgtaacaatttcacctatgcgtgtatgtgttg |
37699507 |
T |
|
| Q |
117 |
gtgtgttcgtctagtgactaaagaagaaagattcatctaagaggaaattaatttaggtagtttatacgtggaggaccaatcagtaagactgcatgatgat |
216 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37699508 |
gtgtgttcgtctagtggctaaagaagaaagattcatctaagaggaaattaatttaggtagtttatacgtggaggaccaatcagtaagactgcatgatgat |
37699607 |
T |
|
| Q |
217 |
gatgt |
221 |
Q |
| |
|
||||| |
|
|
| T |
37699608 |
gatgt |
37699612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University