View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15026_low_25 (Length: 264)
Name: NF15026_low_25
Description: NF15026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15026_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 133 - 245
Target Start/End: Complemental strand, 40758262 - 40758150
Alignment:
| Q |
133 |
ggcagtggtttgatcatttatctcatgtctgatgtctctctgattcatattgtattcatgatggtggctgatcattcatatagcagtgtgcctacaagaa |
232 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40758262 |
ggcagtggtttgatcattcatctcatgtctgatgtctctatgattcatattatattcatgatggtggctgatcattcatattgcagtgtgcctacaagaa |
40758163 |
T |
 |
| Q |
233 |
gagacaacgtgat |
245 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40758162 |
gagacaacgtgat |
40758150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 14 - 81
Target Start/End: Complemental strand, 40758381 - 40758314
Alignment:
| Q |
14 |
attattctttcggtataaataacatcagcataacagttctttcaacatcaataatatcacaatgctta |
81 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40758381 |
attattctttcagtataaataacatcagcataacaattctttcaacatcaataatatcacaatgctta |
40758314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University