View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15026_low_30 (Length: 225)

Name: NF15026_low_30
Description: NF15026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15026_low_30
NF15026_low_30
[»] chr1 (1 HSPs)
chr1 (12-173)||(48014619-48014781)


Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 12 - 173
Target Start/End: Complemental strand, 48014781 - 48014619
Alignment:
12 attattcttattattgactaatccatagatgacctcgtggtg-cacatgtagttgttgaggtgcaatggaggataatggtagttaaccggaggagtgatt 110  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||    
48014781 attattcttattattgactaatccatagatgacctcgtggtgacacatgtagttgttgaggtgcaatggaggataatggtagttcatcggaggagtgttt 48014682  T
111 ttataaagtatgcgatggaggtgcaatgcaaggaatcaaactctcaaactagggaagatttta 173  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48014681 ttataaagtatgcgatggaggtgcaatgcaaggaatcaaactctcaaactagggaagatttta 48014619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University