View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15029_high_13 (Length: 227)
Name: NF15029_high_13
Description: NF15029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15029_high_13 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 40718800 - 40718574
Alignment:
| Q |
1 |
atatacaaatggaattaagattctacccgaagcatttactgaaccttctactatgcagacattaccatttatgatatttcacgaattcaataaattcata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40718800 |
atatacaaatggaattaagattctacccgaagcatttactgaaccttctactatgcagacattaccatttatgatatttcacgaattcaataaattcata |
40718701 |
T |
|
| Q |
101 |
attaaaccgttcgattggataaaatagattcagattccacacgtgagttttgcttctttaaccaatttgaaatccatgcaacactcaactcaaacactaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40718700 |
attaaaccgttcgattggataaaatagattcagattccacacgtgagttttgcttctttaaccaatttgaaatccatgcaacactcaactcaaacactaa |
40718601 |
T |
|
| Q |
201 |
taaattttactccactttgtaaagttt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40718600 |
taaattttactccactttgtaaagttt |
40718574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University