View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15029_high_8 (Length: 271)
Name: NF15029_high_8
Description: NF15029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15029_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 10 - 255
Target Start/End: Complemental strand, 7627179 - 7626934
Alignment:
| Q |
10 |
aagaatattatggaaatattgtttctcagttattttttggtgaatattcttgattttttatggttccttagccgttgattctcaatttttgtatcattgt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7627179 |
aagaatattatggaaatattgtttctcagttattttttggtaaatattcttgattttttatggttccttagccgttgattctcaatttttgtatcaatgt |
7627080 |
T |
 |
| Q |
110 |
gctatgattccgctcatagtttagattatggtcgatctggttgcatataccaaatgcaatatcaaccattaatatggtaacatttgtgtctaagccacag |
209 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| || ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7627079 |
gctatgattccgctcatagtttaggttatggtcgaccttgttgcatatcccaaatgcaatatcaaccattaacatggtaacatttgtgtctaagccacaa |
7626980 |
T |
 |
| Q |
210 |
cttgataaatatgcaaatgtagggcatgtgtcttggaacttggaag |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7626979 |
cttgataaatatgcaaatgtagggcatgtgtcttggaacttggaag |
7626934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University