View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15029_low_14 (Length: 271)

Name: NF15029_low_14
Description: NF15029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15029_low_14
NF15029_low_14
[»] chr8 (1 HSPs)
chr8 (10-255)||(7626934-7627179)


Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 10 - 255
Target Start/End: Complemental strand, 7627179 - 7626934
Alignment:
10 aagaatattatggaaatattgtttctcagttattttttggtgaatattcttgattttttatggttccttagccgttgattctcaatttttgtatcattgt 109  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
7627179 aagaatattatggaaatattgtttctcagttattttttggtaaatattcttgattttttatggttccttagccgttgattctcaatttttgtatcaatgt 7627080  T
110 gctatgattccgctcatagtttagattatggtcgatctggttgcatataccaaatgcaatatcaaccattaatatggtaacatttgtgtctaagccacag 209  Q
    |||||||||||||||||||||||| |||||||||| || ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||     
7627079 gctatgattccgctcatagtttaggttatggtcgaccttgttgcatatcccaaatgcaatatcaaccattaacatggtaacatttgtgtctaagccacaa 7626980  T
210 cttgataaatatgcaaatgtagggcatgtgtcttggaacttggaag 255  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
7626979 cttgataaatatgcaaatgtagggcatgtgtcttggaacttggaag 7626934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University