View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15029_low_17 (Length: 251)
Name: NF15029_low_17
Description: NF15029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15029_low_17 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 61 - 251
Target Start/End: Complemental strand, 17359655 - 17359466
Alignment:
| Q |
61 |
gtaggtcgcttggtggtgctgaatattgatttctataaccaaattgacatttgacagactaataaaaaatgtgacgttatccaggagtnnnnnnnnnnnn |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17359655 |
gtaggtcgcttggtggtgctgaatattgatttctataaccaaattgacatttgacagactaaaaaaaaatgtgacgttatccaggagtaaaaaaaaaaaa |
17359556 |
T |
|
| Q |
161 |
gaaatgtgacgtttattcatttgtctaaattataaactaactcaacaagctctgccacaagtttttataatagaatttatggtcataattt |
251 |
Q |
| |
|
||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17359555 |
gaa-tgtgacgtttattcatttgtctcaattataaactaactcaacaagctctgccacaagtttttataatagaatttatggtcataattt |
17359466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University