View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15029_low_21 (Length: 227)
Name: NF15029_low_21
Description: NF15029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15029_low_21 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 481232 - 481459
Alignment:
| Q |
1 |
aaacaacttaatgctgcttctttcaaacaaaatttgtttattcaagcatgctctagatttttaaagacttttcac-aacaaactttcataatnnnnnnng |
99 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
481232 |
aaacaacttaatgttgcttctttcaaacaaaatttgtttattcaagcatgctctagatttttaaagacttttcacaaacaaactttcataataaaaaaag |
481331 |
T |
 |
| Q |
100 |
cataaacttattttaacgaggaactattccaagctgagtaaaagtattgtatagtttcaacaaaccttnnnnnnngaatattattttctgtttacaaata |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
481332 |
cataaacttattttaacgaggaactattccaagctgagtaaaagtattgtatagtttcaacaaaccttaaaaaaagaatattattttctgtttacagata |
481431 |
T |
 |
| Q |
200 |
ttgactcaaaataccttattgatatttt |
227 |
Q |
| |
|
||||| |||||||| | ||||||||||| |
|
|
| T |
481432 |
ttgacccaaaatacttaattgatatttt |
481459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University