View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1502_low_6 (Length: 272)
Name: NF1502_low_6
Description: NF1502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1502_low_6 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 14 - 272
Target Start/End: Complemental strand, 35094680 - 35094422
Alignment:
| Q |
14 |
atatgtccttgttaaaagaagaaaaactaaacaacaagaagaattaggagaaggagctggagtagctgcaaacaccagcaacagggataataataatcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35094680 |
atatgtccttgttaaaagaagaaaaactaaacaacaagaagaattaggagaaggagctggagtagctgcaaacaccagcaacagggataataataatcaa |
35094581 |
T |
|
| Q |
114 |
aagaaaggatcatcatcaaataataatacagacgagggttcggtaagatcacgcgcaagcagtaataccagtagcagaaaaggagatagcaagttgtcct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35094580 |
aagaaaggatcatcatcaaataataatacagacgagggttcggtaagatcacgcacaagcagtaataccagtagcagaaaaggagatagcaagttgtcct |
35094481 |
T |
|
| Q |
214 |
ttgtgagggaagaagtatcagcacaatttgatttgcaagatcttttgagagccgctgct |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35094480 |
ttgtgagggaagaagtatcagcacaatttgatttgcaagatcttttgagagccgctgct |
35094422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University