View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1502_low_8 (Length: 242)
Name: NF1502_low_8
Description: NF1502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1502_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 14 - 111
Target Start/End: Original strand, 40519168 - 40519265
Alignment:
| Q |
14 |
agggagaaaagaaaagcatatatcgtgaattaaatatcaaattgtgtgggatcctgacgttaaatgcatgaaattcgatcaaaaagtataattcagat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40519168 |
agggagaaaagaaaagcatatatcgtgaattaaatatcaaattgtgtgggatcctgatggtaaatgcatgaaattcgatcaaaaagtataatttagat |
40519265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 40519253 - 40519363
Alignment:
| Q |
129 |
gtataattcagattggtttgtttgtatttaattaaggacaaaatttgtcactaaatgttatttttagtttgtaggcaaaaatccgaagac-aacaacttt |
227 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||||||||| |
|
|
| T |
40519253 |
gtataatttagattggtttgtttgtatttaaa----gacaaaatttgtcactaaatgttatttttagtctgtaggcgaaaatccgaagacaaacaacttt |
40519348 |
T |
 |
| Q |
228 |
gttgtaggtaaaacc |
242 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
40519349 |
gttgtaggcaaaacc |
40519363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University