View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1502_low_9 (Length: 240)
Name: NF1502_low_9
Description: NF1502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1502_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 23 - 222
Target Start/End: Original strand, 10467694 - 10467893
Alignment:
| Q |
23 |
atacattttcataattaattagtagctnnnnnnngtagacatgataatctcgtggtgatgcaggaagcaatggagcaagttgtatgcttaaaaagtaggt |
122 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10467694 |
atacattttcataattaattagtagctaaaaaaagtagacatgataatctcgtggtgatgcagcaagcaatggagcaagttgtatgcttaaaaagtaggt |
10467793 |
T |
|
| Q |
123 |
aagaggcaagatattaatattatacaaaatgaaatacttttttggtggtgtatacaaaatgaagactttgaaaaagtagatggatccgttaacctcttac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10467794 |
aagaggcaagatattaatattatacaaaatgaaatacttttttggtggtgtatacaaaatgaagactttgaaaaagtagatggatccgttaacctcttac |
10467893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University