View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15030_low_10 (Length: 266)
Name: NF15030_low_10
Description: NF15030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15030_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 22 - 255
Target Start/End: Complemental strand, 36638019 - 36637786
Alignment:
| Q |
22 |
tagggtataaagcatatggatttagaatgtttggatggattgcattgatcctaactattgaatctcaccactaattattttgaattgagttcaaaagtga |
121 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36638019 |
tagggtataaagcataaggatttagaatgtttggatggattgcattgatcctaactattgaatctcaccactaattattttgaattgagttcaaaagtga |
36637920 |
T |
 |
| Q |
122 |
cgttgtcaatacccatgtctagctctcatctctattgcatagcatgaagtaacccaaatgtcataccttcatgaatgtttaaccttgaccagaaattgga |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36637919 |
cgttgtcaatacccatgtctagctctcatctctattgcatagcatgaagcaaaccaaatgacataccttcatgaatgtttaaccttgaccagcaattgga |
36637820 |
T |
 |
| Q |
222 |
gattttttccttgaacgaaaggaaaatgcttctt |
255 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
36637819 |
gattttttccttgaaggaaaggaaaatgcttctt |
36637786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University