View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15030_low_12 (Length: 260)
Name: NF15030_low_12
Description: NF15030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15030_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 29 - 245
Target Start/End: Original strand, 52924742 - 52924958
Alignment:
| Q |
29 |
aatattgaagtgaaccaactaacttatggtttgattggattggacattggaacagatcttggaagctactggagttgccaattaattggtgaagatgaga |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52924742 |
aatattgaagtgaaccaactaacttatggtttgattggattggacattggaacagatcttggaagctactggagttgccaattaattggtgaagatgaga |
52924841 |
T |
 |
| Q |
129 |
tttttggagtttgggtgtgttctgttgattgttgtactagctcttgtggtttctgtaaaaggtgagatttatatagtaactgttgaaggtgaacctatca |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52924842 |
tttttggagtttgggtgtgttctgttgattgttgtactagctcttgtggtttctgtaaaaggtgagatttatatagtaactgttgaaggtgaacctatca |
52924941 |
T |
 |
| Q |
229 |
taagttatactggaggt |
245 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
52924942 |
taagttatactggaggt |
52924958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 196 - 241
Target Start/End: Complemental strand, 16397670 - 16397625
Alignment:
| Q |
196 |
tttatatagtaactgttgaaggtgaacctatcataagttatactgg |
241 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
16397670 |
tttacatagtaactgttgaaggtgagcctatcataagttacactgg |
16397625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University