View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15030_low_14 (Length: 240)
Name: NF15030_low_14
Description: NF15030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15030_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 2332392 - 2332181
Alignment:
| Q |
18 |
atagttacaggcaagagaagctggtccatcaagttaatgctaagagatggaatattatccagttgtaaactatatgagaggtttacagggatcatttgat |
117 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2332392 |
atagtgacaggcaagagaagctggtccatcaagctaatgccaagagatggaatattatccagttgtaaactatatgagaggtttacagggatcatttgat |
2332293 |
T |
 |
| Q |
118 |
tggaatagattcataaaaaactttgaggcttcccttttgagagtgcttgcattcgtgcaccatatgttttccacattcaaaccagaaattttatttcgtc |
217 |
Q |
| |
|
||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2332292 |
tgggatagatgcataaaaaactttgaggcttcccttttgagagtgcttgcattcgtgcacc--atgttttccacattcaaaccagaaattttatttcgcc |
2332195 |
T |
 |
| Q |
218 |
gtcttctgatgatg |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
2332194 |
gtcttctgatgatg |
2332181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University