View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15030_low_16 (Length: 231)
Name: NF15030_low_16
Description: NF15030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15030_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 14 - 220
Target Start/End: Original strand, 52590553 - 52590763
Alignment:
| Q |
14 |
cagtcacaacatattatgtaagtgtctttcattaaatatgtgtttttattatttaatcttcaatcgaaatgtttaagatgaattaaattgatgaaatata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52590553 |
cagtcacaacatattatgtaagtgtctttcattaaatatgtgtttttattatttaatcttcaatcgaaatgtttaagatgaattaaattgatgaaatata |
52590652 |
T |
|
| Q |
114 |
tttttactgaat----atttgttatgattgttgcagctatcttctcttggtgatgctcatgatgaaatagattttgaatttttgggtaacttaagtggtg |
209 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52590653 |
tttttactgaatattaatttgttatgattgttgcagctatcttctcttggtgatgctcatgatgaaatagattttgaatttttgggtaacttaagtggtg |
52590752 |
T |
|
| Q |
210 |
atccttatatt |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
52590753 |
atccttatatt |
52590763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 134 - 220
Target Start/End: Original strand, 16942094 - 16942180
Alignment:
| Q |
134 |
tgattgttgcagctatcttctcttggtgatgctcatgatgaaatagattttgaatttttgggtaacttaagtggtgatccttatatt |
220 |
Q |
| |
|
|||||| |||||||||||||||| || | |||||||||||||||| ||||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
16942094 |
tgattgatgcagctatcttctctagggtctactcatgatgaaatagactttgaatttcttggtaacttgagtggtgatccttatatt |
16942180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 134 - 220
Target Start/End: Original strand, 17012759 - 17012845
Alignment:
| Q |
134 |
tgattgttgcagctatcttctcttggtgatgctcatgatgaaatagattttgaatttttgggtaacttaagtggtgatccttatatt |
220 |
Q |
| |
|
|||||| |||||||||||||||| || | |||||||||||||||| ||||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
17012759 |
tgattgatgcagctatcttctctagggtctactcatgatgaaatagactttgaatttcttggtaacttgagtggtgatccttatatt |
17012845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Original strand, 32708692 - 32708724
Alignment:
| Q |
166 |
tcatgatgaaatagattttgaatttttgggtaa |
198 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
32708692 |
tcatgatgaaatagattttgagtttttgggtaa |
32708724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University