View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15030_low_18 (Length: 211)
Name: NF15030_low_18
Description: NF15030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15030_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 24 - 192
Target Start/End: Original strand, 38096323 - 38096491
Alignment:
| Q |
24 |
tacaacaaattccactactacccttgctgagaaactgaaacaaagagaagaaagaagggtcaacaatgtcaaagatagtaactatccaacgacgtcggca |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38096323 |
tacaacaaattccactactacccttgctgagaaactgaaacaaagagaagaaagaagggtcaacaatgtcaaagataataactatccaacgacgtcggca |
38096422 |
T |
 |
| Q |
124 |
ccatcgactacgtcgagtcgttactctgttttgctgcagctgatagcgtgtggaagttcaggtgcagag |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096423 |
ccatcgactacgtcgagtcgttactctgttttgctgcagctgatagcgtgtggaagttcaggtgcagag |
38096491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University