View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15033_low_12 (Length: 210)
Name: NF15033_low_12
Description: NF15033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15033_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 20 - 196
Target Start/End: Complemental strand, 5230345 - 5230169
Alignment:
| Q |
20 |
ccatactcattctcaatctatggattcaaatggatacccattttcattattagattaaattaagcataacttattattgtaattggctgcaacctaaact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5230345 |
ccatactcattctcaatctatggattcaaatggatacccattttcattattagattaaattaggcataacttattattgtaattggctgcaacataaact |
5230246 |
T |
|
| Q |
120 |
atataatnnnnnnntgttacccaaaataagacaacatatttaaatataatttctttatttacctgagacagaattat |
196 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5230245 |
atataataaaaaaatgttacccaaaataagacaacatatttaaatataatttctttatttacctgagacataattat |
5230169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University