View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15034_low_12 (Length: 257)
Name: NF15034_low_12
Description: NF15034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15034_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 34 - 196
Target Start/End: Original strand, 54150913 - 54151075
Alignment:
| Q |
34 |
aatactcaagtaatgaatgctatattagctatggtaagatattctctgattttcttctactattcatctgtgattttatcattccactcttgtttatgat |
133 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54150913 |
aatactcaagtaatgaatgatatattagctatggtaagatattctctaattttcttctactattcatctgtgattttatcattccactcttgtttatgat |
54151012 |
T |
|
| Q |
134 |
ttttattttctactttcagattgctgaggatcatgctggaaagcaaattgatcgaaaattgat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54151013 |
ttttattttctactttcagattgctgaggatcatgctggaaagcaaattgatcgaaaattgat |
54151075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 188 - 233
Target Start/End: Original strand, 54151122 - 54151167
Alignment:
| Q |
188 |
aaaattgataaaaaatacgttgattgaaagagaatgtaacattata |
233 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54151122 |
aaaattgatccaaaatacgttgattgaaagagaatgtaacattata |
54151167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University