View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15035_high_11 (Length: 250)
Name: NF15035_high_11
Description: NF15035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15035_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 23 - 243
Target Start/End: Original strand, 6191344 - 6191563
Alignment:
| Q |
23 |
agcttgtaattttgtaaggattgaaaatatatttagcccttttagtcttaaccgaagttcatataatataagaattttgaaatctcctaaaaagctctaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6191344 |
agcttgtaattttgtaaggattgaaaatatatttagcccttttaatcttaatcaaagttcatataatataagaattttgaaatctcctaaaaagctctaa |
6191443 |
T |
|
| Q |
123 |
aatctcctttttgatgacatattcgcatgcataggaatgttacgataactctgtagcttgttcttttcttgggctttgccctcttttgataaaaataaat |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6191444 |
aatctcctttttgatgacatattcacatgcataggaatgttacgataactttgtagcttgttcttttcttgggctttgccctc-tttgataaaaataaat |
6191542 |
T |
|
| Q |
223 |
aaatcgtacttagaataattt |
243 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6191543 |
aaatcgtacttagaataattt |
6191563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University