View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15035_high_14 (Length: 207)
Name: NF15035_high_14
Description: NF15035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15035_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 42 - 191
Target Start/End: Complemental strand, 18646433 - 18646284
Alignment:
| Q |
42 |
cagttcagttaaccagtaacacagtaaaacataaaaatcataatcatttacaggatcgatatcccaatatatagtgcactataagccattctataacccc |
141 |
Q |
| |
|
|||| |||||| |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18646433 |
cagtacagttagccagaaacacagtaaaacataaaaatcaagatcatttacaggatcgatatcccaatatatagtgcactataagccattctataacccc |
18646334 |
T |
|
| Q |
142 |
tatattttgacttgtttttcaagtaataacctcgataaagatgagactat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18646333 |
tatattttgacttgtttttcaagtaataacctcgataaagatgaaactat |
18646284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University