View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15035_low_16 (Length: 221)
Name: NF15035_low_16
Description: NF15035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15035_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 211
Target Start/End: Original strand, 51652817 - 51653009
Alignment:
| Q |
19 |
gtaccgtgtgatttgtgacaccaagggagctttcgtgcaacctgctgtgtatgaagctttcggtttgacagttgttgaggccatggctactggattgcca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
51652817 |
gtaccgtgtgatttgtgacaccaagggagctttcgtgcaacctgctgtgtatgaagctttcggtttgacagttgttgaggccatggctactggattacca |
51652916 |
T |
 |
| Q |
119 |
acatttgcaactcttaatggtggccctgctgagatcattgtccatggcaaatctggattccacattgatccttaccatggcgtctgtgctgct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
51652917 |
acatttgcaactcttaatggtggccctgctgagatcattgtccatggcaaatctggattccacattgatccttaccatggcgaccgtgctgct |
51653009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 20 - 198
Target Start/End: Complemental strand, 19152917 - 19152739
Alignment:
| Q |
20 |
taccgtgtgatttgtgacaccaagggagctttcgtgcaacctgctgtgtatgaagctttcggtttgacagttgttgaggccatggctactggattgccaa |
119 |
Q |
| |
|
|||||||| ||||| ||||| ||||||||||| ||||| |||||| | ||||||||||| |||||||| |||||||| || ||| || ||||||||| | |
|
|
| T |
19152917 |
taccgtgtcatttgcgacacaaagggagcttttgtgcagcctgctatttatgaagcttttggtttgactgttgttgaagctatgacttgtggattgccga |
19152818 |
T |
 |
| Q |
120 |
catttgcaactcttaatggtggccctgctgagatcattgtccatggcaaatctggattccacattgatccttaccatgg |
198 |
Q |
| |
|
|||| ||||| ||||||||| ||||||||||||||||| ||||| |||||||| | ||| ||||||||||| ||||| |
|
|
| T |
19152817 |
cattcgcaacgtgtaatggtggtcctgctgagatcattgttcatggaaaatctggttaccatattgatccttatcatgg |
19152739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University