View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15036_high_16 (Length: 357)
Name: NF15036_high_16
Description: NF15036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15036_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 20 - 346
Target Start/End: Complemental strand, 53057581 - 53057255
Alignment:
| Q |
20 |
atatgacctctctcataaattttttcactatgattcccccacataactttaggcctcacctcgtgttggattttctgaggccagagttgcagatgaatta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53057581 |
atatgacctctctcataaattttttcactgtgattcccccacataactttaggcctcacctcgtgttggattttctgaggccagagttgcagatgaatta |
53057482 |
T |
 |
| Q |
120 |
agtactactgttaagggctttatggtcggtactgcctgccactgctgctgtcatcatataatcatagactgacatgttagttggtttcattgttgtctaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
53057481 |
agtactactgttaagggctttatggtaggtactgcctgccactgctgctgtcatcatataatcataaactgacatgttagttggtttcattgttgcctaa |
53057382 |
T |
 |
| Q |
220 |
atctattgttcatgttacatcctacttcaattttcatgtcaatgttttaaaacagaccgaatcggccagttctaccaattgaaccgaaaactggccaatt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53057381 |
atctattgttcatgttacatcctacttcaattttcatgtcaatgttttaaaacagaccgaatcggccagttctaccaattgaaccgaaaactggccaatt |
53057282 |
T |
 |
| Q |
320 |
cactggttggtggttggtttgattcat |
346 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
53057281 |
cactggttggtggttggtttgattcat |
53057255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University