View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15036_high_17 (Length: 355)
Name: NF15036_high_17
Description: NF15036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15036_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 2e-80; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 18 - 169
Target Start/End: Complemental strand, 36881748 - 36881597
Alignment:
| Q |
18 |
tcaacaataacgggttgtcttgacttcactgcaacatgcaatacattttctttccttgagtttgtgtcatgaatggcacttggaattttgtctagaaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36881748 |
tcaacaataacgggttgtcttgacttcactgcaacatgcaatacattttctttccttgagtttgtgtcatgaatggcacttggaattttgtctagaaatt |
36881649 |
T |
|
| Q |
118 |
cgttaaccagttcaactattccatttttcgctgcaaccaaaaatggtgtctc |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36881648 |
cgttaaccagttcaactattccatttttcgctgcaaccaaaaatggtgtctc |
36881597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 229 - 344
Target Start/End: Complemental strand, 36881537 - 36881422
Alignment:
| Q |
229 |
gagttgatatggtttcctgtatctcattttgtttaggtttttgttcttgttcatcaaaccttttggtttcacctgccagtgacaaatgcaatggaaggtg |
328 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36881537 |
gagttgatatggttttctgtatctcattttctttaggtttttgttcttgttcatcgaacctattggtttcacctgccagtgacaaatgcaatggaaggtg |
36881438 |
T |
|
| Q |
329 |
taaaaatgccattcat |
344 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
36881437 |
taaaaatgtcattcat |
36881422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 45 - 167
Target Start/End: Complemental strand, 36892811 - 36892689
Alignment:
| Q |
45 |
actgcaacatgcaatacattttctttccttgagtttgtgtcatgaatggcacttggaattttgtctagaaattcgttaaccagttcaactattccatttt |
144 |
Q |
| |
|
||||||||| |||||||||||||||| |||||| | |||| ||||||||||||||| | ||| ||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
36892811 |
actgcaacaagcaatacattttcttttcttgaggtagtgttatgaatggcacttggtacttttattagaatttcgttaaccatttcaactattccatttt |
36892712 |
T |
|
| Q |
145 |
tcgctgcaaccaaaaatggtgtc |
167 |
Q |
| |
|
| ||||||||||||||||||||| |
|
|
| T |
36892711 |
ttgctgcaaccaaaaatggtgtc |
36892689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University