View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15036_high_25 (Length: 315)
Name: NF15036_high_25
Description: NF15036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15036_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 174 - 297
Target Start/End: Complemental strand, 29280376 - 29280253
Alignment:
| Q |
174 |
ggttgttcctatactcaatcaaaaagaataaaagtaaccaaattagtaccatggtccaagaacttatgttgactcactaatggccattttacaactgtcg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29280376 |
ggttgttcctatactcaatcaaaaagaataaaagtaaacaaattagtaccatggtccaagaacttatgttgactcactaatgaccattttacaactgtcg |
29280277 |
T |
 |
| Q |
274 |
tcaaagaattttgaaccattgttt |
297 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
29280276 |
ttaaagaattttgaaccattgttt |
29280253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 17 - 58
Target Start/End: Complemental strand, 29280533 - 29280492
Alignment:
| Q |
17 |
atgcaaatccacaaaaagcacacatggttctggtggtttagg |
58 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29280533 |
atgcaaatccacaaaaagtacacatggttctggtggtttagg |
29280492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University