View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15036_high_32 (Length: 273)
Name: NF15036_high_32
Description: NF15036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15036_high_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 41459593 - 41459339
Alignment:
| Q |
1 |
ctcgcaaagaataaagataaattagtcttaagcaagacaactaagctgaatctagaataacatnnnnnnntcagaaaaggagaaacgcgaaacaaaaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41459593 |
ctcgcaaagaataaagataaattagtcttaagcaagacaactaagctgaatctagaataacataaaaaaatcagaaaaggagaaacgcgaaacaaaaata |
41459494 |
T |
|
| Q |
101 |
tggttcgggaacatgaaccggaaaatacctgaatctacatattcaggagctgcatatccattatttcctactaacgtgttggtgaagatgtgacttttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41459493 |
tggttcgggaacatgaaccggaaaatacctgaatctacatattcaggagctgcatatccattatttcctactaacgtgttggtgaagatgtgacttttgt |
41459394 |
T |
|
| Q |
201 |
cacctgttgaaccatcccttgccagcccaaaatcagaaagctttgcattataatc |
255 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41459393 |
cacctgttggaccatcccttgccagcccaaaatcagaaagctttgcattataatc |
41459339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 122 - 255
Target Start/End: Complemental strand, 41442679 - 41442549
Alignment:
| Q |
122 |
aaaatacctgaatctacatattcaggagctgcatatccattatttcctactaacgtgttggtgaagatgtgacttttgtcacctgttgaaccatcccttg |
221 |
Q |
| |
|
|||||||||| | ||| ||||||||||||||||||||||| |||| | || | || ||| ||| ||| |||||||||||||||| ||||||| ||| |
|
|
| T |
41442679 |
aaaatacctgtagctagatattcaggagctgcatatccataggttcccattaccctggtgg---agacgtggcttttgtcacctgttggaccatcctttg |
41442583 |
T |
|
| Q |
222 |
ccagcccaaaatcagaaagctttgcattataatc |
255 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
41442582 |
ccagcccgaaatcagaaagctttgcattataatc |
41442549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 226
Target Start/End: Complemental strand, 41449032 - 41448986
Alignment:
| Q |
180 |
tggtgaagatgtgacttttgtcacctgttgaaccatcccttgccagc |
226 |
Q |
| |
|
||||| ||| ||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
41449032 |
tggtggagacgtgacttttctcacctgttggaccatcccttgccagc |
41448986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University