View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15036_high_37 (Length: 256)
Name: NF15036_high_37
Description: NF15036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15036_high_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 16 - 230
Target Start/End: Complemental strand, 8914427 - 8914212
Alignment:
| Q |
16 |
gttcttgatcctccaacaaatattcttttggtgattacaatagataggatggatgttacttatcatcgtggataataacattttctat--tgnnnnnnn- |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||||| |||| |||||| ||||||| ||||| ||||||| | || |
|
|
| T |
8914427 |
gttcttgatcctccaacaaatattcttttggtgcttacgatagataggatgagtgttgcttatcgtcgtggacaataatattttctttgttgtttttttg |
8914328 |
T |
 |
| Q |
113 |
ctttgtctcttctcttgtaacnnnnnnnnnnnncatgactgcaaaatataattcaaaatttagaaagatacaaatgagtttatttaaaagcatggaccaa |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8914327 |
ctttgtctcttctcttgtaacaaaaaaaaaa--catgactgcaaaatataattcaaaatttaaaaagatacaaatgagtttatttaaaagcatggaacaa |
8914230 |
T |
 |
| Q |
213 |
aagccttgactaaaaaca |
230 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
8914229 |
aaggcttgactaaaaaca |
8914212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 211
Target Start/End: Complemental strand, 30673589 - 30673527
Alignment:
| Q |
149 |
gactgcaaaatataattcaaaatttagaaagatacaaatgagtttatttaaaagcatggacca |
211 |
Q |
| |
|
|||||||||| |||||| ||||||| |||||||||||| | |||| ||||||| |||||||| |
|
|
| T |
30673589 |
gactgcaaaaaataatttaaaatttttaaagatacaaataattttacttaaaagtatggacca |
30673527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 16 - 101
Target Start/End: Complemental strand, 14801543 - 14801458
Alignment:
| Q |
16 |
gttcttgatcctccaacaaatattcttttggtgattacaatagataggatggatgttacttatcatcgtggataataacattttct |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||||| |||| |||||| ||||||| ||||| ||||||| |
|
|
| T |
14801543 |
gttcttgatcctccaacaaatattcttttggtgcttacgatagataggatgagtgttgcttatcgtcgtggacaataatattttct |
14801458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University