View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15036_high_40 (Length: 255)
Name: NF15036_high_40
Description: NF15036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15036_high_40 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 162
Target Start/End: Complemental strand, 32343441 - 32343297
Alignment:
| Q |
18 |
gtttaggtggtggttatggaggaggtggaatatctaagggaattgtaggtggaattggaggttatggaggtggaacatctaagggaattggaggtggaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32343441 |
gtttaggtggtggttatggaggaggtggaatatctaagggaattgttggtggaattggaggttatggaggtggaatatctaagggaattggaggtggaat |
32343342 |
T |
|
| Q |
118 |
tggaggttttgcttacaaaggaattggaggaggtgtaggagggat |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32343341 |
tggaggttttgcttacaaaggaattggaggaggtgtaggagggat |
32343297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University