View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15036_low_28 (Length: 319)
Name: NF15036_low_28
Description: NF15036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15036_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 3 - 301
Target Start/End: Original strand, 4266445 - 4266743
Alignment:
| Q |
3 |
attattggtagattggactaatatgaaggtgcaagcaatgtacgctctacaccgcaagcacaaacatgcattgctctttctttctttttaataataaacg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4266445 |
attattggtagattggactaatatgaaggtgcaagcaatgtacgctctacaccgcaggcacaaacatgcattgctctttctttctttttaataataaacg |
4266544 |
T |
|
| Q |
103 |
ataatatgttagtttttgtcataacttaaccatgaacctcaaacttcttaacccttaactcaaatagttgagtctcccaacccatgcattactccttaat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4266545 |
ataatatgttagtttttgtcataacttaaccatgaacctcaaacttcttaacccttaactcaaatagttgagtctcccaacccatgcattactccttaac |
4266644 |
T |
|
| Q |
203 |
aatcactatgtaatgaaaataaagggtgatcaatcggtcacaacgcaaatccctcaaggacctcaatggatttttcatccatttccctagaaactcttg |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4266645 |
aatcactatgtaatgaaaataaagggtgatcaatcggtcacaacgcaaatccctcaaggacctcaatggatttttcatccatttccctagaaactcttg |
4266743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University