View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15036_low_34 (Length: 299)
Name: NF15036_low_34
Description: NF15036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15036_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 57 - 214
Target Start/End: Original strand, 2162423 - 2162581
Alignment:
| Q |
57 |
ttgtttaaattttaatcgggtcc-tttaaattcatgtggggactacatgatttattggagtcctttagaatctcaaccaaattagagataattgttgaaa |
155 |
Q |
| |
|
|||||| ||| |||| ||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2162423 |
ttgtttgaatcttaaacgggtccctttaaattcatgtggggactacatgatttaatggagtcctttagaatctcaaccaaattagagataattgttgaaa |
2162522 |
T |
 |
| Q |
156 |
aaagtgtgttagaaggtttttattttgcatttctttagatacatacatttatgagattt |
214 |
Q |
| |
|
||||||||||||||||||| || || ||||||||||||||||||||||||||||||||| |
|
|
| T |
2162523 |
aaagtgtgttagaaggtttgtagttcgcatttctttagatacatacatttatgagattt |
2162581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University