View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15036_low_38 (Length: 271)
Name: NF15036_low_38
Description: NF15036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15036_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 27781756 - 27781523
Alignment:
| Q |
1 |
gggtctttagatgttacattgtgtgccggactgacgattagttccataggcggcacaaaatgttgaagcttgtagggataattggggg-aattgtctaat |
99 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
27781756 |
gggtctttagattttacattgtgtgccggactgacgattagttccataggcggcacaaaatgttgaagcttgtaggggtaattggggggaattgtctaat |
27781657 |
T |
 |
| Q |
100 |
tgcgctttatttagactaattatgtgtagttacgctactacgtgtaaactccaatttttcatgaccttatttctacaattgacttggcagcagcagcaga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27781656 |
tgcgctttatttagactaattatgtgtagttacgctactacgtgtaaactccaatttttcatgaccttatttctacaattgacttggcagcagcagcaga |
27781557 |
T |
 |
| Q |
200 |
agaatattgatatcaataatctggaaacaaagtt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27781556 |
agaatattgatatcaataatctggaaacaaagtt |
27781523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University