View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15036_low_47 (Length: 253)
Name: NF15036_low_47
Description: NF15036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15036_low_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 4 - 242
Target Start/End: Complemental strand, 41747854 - 41747616
Alignment:
| Q |
4 |
atggtttctttttcgatcacaatgtcgtggatgaaagttttgattctgcagcgaggggtaaaattggaatgtgttggattttcttcttcgtcagaagaag |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41747854 |
atggtttctttttcgatcacaatgtcgtggatgaaagttttgattctgcggcgaggggtaatattggaatgtattggattttcttcttcgtcagaagaag |
41747755 |
T |
|
| Q |
104 |
aatccgtggcgtcagggtcggtgtaacgtatttgtatagtttttggcatgatgttgttgatttgtgtgaagtgatgagtgtgtttgatgatgttaggaat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41747754 |
aatccgtggcgtcagggtcggtgtaacgtatttgtatagtttttggcatgatgttgttgatttgtgtgaagtgatgagtgtgtttgatgatgttgggaat |
41747655 |
T |
|
| Q |
204 |
aggaggaggtgtagaaggttgtttaggcatattgttgga |
242 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
41747654 |
gggaggaggtgtagaaggttgtttgggcatgttgttgga |
41747616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University