View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15036_low_50 (Length: 234)
Name: NF15036_low_50
Description: NF15036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15036_low_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 35953687 - 35953834
Alignment:
| Q |
1 |
cttttttgtgtgtttcattgtagaagcat--ggtgtacaatttatagactttnnnnnnnnnnnntaaacgaagtcacacgacactcttctacgtacgtaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35953687 |
cttttttgtgtgtttcattgtagaagcatatggggtacaatttatagactttgagagagagagataaacgaagtcacacgacactcttctacgtacgtaa |
35953786 |
T |
 |
| Q |
99 |
tctcaagtctaacaattaatgcatttcaaccgtttgatcagtcatatg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35953787 |
tctcaagtctaacaattaatgcatttcaaccgtttgatcagtcatatg |
35953834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University