View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15037_low_4 (Length: 399)
Name: NF15037_low_4
Description: NF15037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15037_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 62 - 380
Target Start/End: Original strand, 33338032 - 33338350
Alignment:
| Q |
62 |
ccaaaaacaccttgaatgatagtgcaactgtaggggactactgaaatttgaatgtaaaaaaccctagtttttcttcttatctttacctgtttcttatccc |
161 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33338032 |
ccaaaaacaccttgaacgatagtgcaacggtaggggactactgaaatttgaatgtaagaaaccctagtttttcttcttatctttacctgtttcttatccc |
33338131 |
T |
|
| Q |
162 |
attatataagtgtttatatttggttagggatgatgaacctttgttagattcttgtgcaagtatgactcacattgcttcaatactagttttattcatgctt |
261 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33338132 |
attatgtaggtgtttatatttggttagggatgatgaacctttgttagattcttgtgtaagtatgactcacattgcttcaatactagttttattcatgctt |
33338231 |
T |
|
| Q |
262 |
attgagtaattacttctatgtttaatgctttacattgattgactatctttaaatttaatgtagattcaatctcacaattggaatacgaagttgattgcag |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33338232 |
attgagtaattacttctatgtttaatgcttttcattgattgactatctttaaatttaatgtagattcaatctcacaattggaatacgaagttgattgcca |
33338331 |
T |
|
| Q |
362 |
tgctcgtgatgatcctagg |
380 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33338332 |
tgctcgtgatgatcctagg |
33338350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 333 - 399
Target Start/End: Original strand, 33338374 - 33338440
Alignment:
| Q |
333 |
tcacaattggaatacgaagttgattgcagtgctcgtgatgatcctaggccctagggataggacatca |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33338374 |
tcacaattggaatacgaagttgattgcagtgctcgtgatgatcctaggccctagggataggacatca |
33338440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University