View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15037_low_5 (Length: 300)
Name: NF15037_low_5
Description: NF15037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15037_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 19 - 289
Target Start/End: Complemental strand, 52152008 - 52151748
Alignment:
| Q |
19 |
cctgccaggatttatccatctggatcacgaagatgtatcagnnnnnnncggattaacccattcagatgcaagaaaaatgtgnnnnnnnnatctcatctag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52152008 |
cctgccaggatttatccatctggatcacgaagatgtatcagtttttttcggattaacccattcagatgcaagaaaaatgtgttttttttatctcatctag |
52151909 |
T |
 |
| Q |
119 |
attgataaatctggaggagtgtgattttagagnnnnnnnn---cagtgggggagtaaaagctgctctccttataatatttgcaacaagtgtagctactgg |
215 |
Q |
| |
|
||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52151908 |
attgataaatctggaggagtgtgatttaaaaaaaaaaaaaaaacagtgggggagtaaaagctgctctccttataatatttgcaacaagtgtagctactgg |
52151809 |
T |
 |
| Q |
216 |
aactctatatcatgggcctatatcagtgggggagaactagtattttggtggtcacagatgttgttgttgttcat |
289 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52151808 |
aactctat-------------atcagtgggggagaactagtattttggtggtcacagatgttgttgttgttcat |
52151748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University