View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15038_high_20 (Length: 343)
Name: NF15038_high_20
Description: NF15038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15038_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 85 - 325
Target Start/End: Complemental strand, 10528586 - 10528346
Alignment:
| Q |
85 |
cacaatcttctatattaaacccacttcgtttcaatttccaaccttatcttagggttttttccgttccctcttctctgtctcaaaaatccctttctttaat |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10528586 |
cacaatcttctatattaaacccacttcgtttcaatttccaaccttatcttagggttttttccgttccctcttctctgtctcaaaaatccctttctttaat |
10528487 |
T |
 |
| Q |
185 |
ttattcattcatgaaggatttgaattccgatctgtttgatccggttacggtgatggaatccgaatgggctcacggtggttctagctccgacgccgatttc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10528486 |
ttattcattcatgaaggatttgaattccgatctgtttgatccggttacggtgatggaatccgaatgggctcacggtggttctagctccgacgccgatttc |
10528387 |
T |
 |
| Q |
285 |
ggatttgctttcaatgatagtaatttttctgatagggtttt |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10528386 |
ggatttgctttcaatgatagtaatttttctgatagggtttt |
10528346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University