View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15038_high_43 (Length: 249)
Name: NF15038_high_43
Description: NF15038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15038_high_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 12 - 220
Target Start/End: Complemental strand, 37068603 - 37068387
Alignment:
| Q |
12 |
atagggcgcgtaagaaattaatatggtagaaaaagtaaaaacattggattggtattggatcttataagactcaacccaacatctttataaggc------- |
104 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||| |||||| |||||||||||||||||||||| |
|
|
| T |
37068603 |
atagggcgcgtaagaaattaatatggtggaaaa-gtaaaaacattggattggtattggaccttgtaagacccaacccaacatctttataaggctttaaga |
37068505 |
T |
 |
| Q |
105 |
-ctgtcctaagtaaaccttaatctcaatcaaaaacaataagaaactctcactttttta-ccttataaaaatcttaagacattgaatatacgagtcttttc |
202 |
Q |
| |
|
||| || |||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37068504 |
cctggcccaagtccgccttaatctcaatcaaaaacaataagaaactctcactttttttgccttataaaaatcttaagacattgaatatatgagtcttttc |
37068405 |
T |
 |
| Q |
203 |
acttaaataatgttcaac |
220 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
37068404 |
acttaaataatgttcaac |
37068387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University