View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15038_high_48 (Length: 220)
Name: NF15038_high_48
Description: NF15038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15038_high_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 4388078 - 4387972
Alignment:
| Q |
1 |
ttgatttgtgtcgctctgccttcctttgtgactccaatcaaacaatttgttgaatcatggagaaagcaaaacatagtaagccgaggaacaagttctttac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4388078 |
ttgatttgtgtcgctctgccttcctttgtgactccaatcaaacaatttgtttaatcatggagaaagcaaaacatagtaagccgaggaacaagttctttac |
4387979 |
T |
 |
| Q |
101 |
agaagca |
107 |
Q |
| |
|
||||||| |
|
|
| T |
4387978 |
agaagca |
4387972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University