View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15038_low_14 (Length: 410)
Name: NF15038_low_14
Description: NF15038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15038_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 18 - 400
Target Start/End: Complemental strand, 21851937 - 21851553
Alignment:
| Q |
18 |
atttggtctctacactagggtgcttgtggatgttgacatgtcaagacatctttttgactcggatatagtggaaagggagggttatgtgttttatgtgtct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21851937 |
atttggtctctacactagggtgcttgtggatgttgacatgtcaagacaactttttgactcggttatagtggaaagggagggttatgcgttttatgtgtct |
21851838 |
T |
|
| Q |
118 |
gtgcagtatgaaaggaaacctcctttttgctcacat--caagttcattggccacactattcaacaatgtaagaagattggagcagctcatgtggctgaag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21851837 |
gtgcagtatgaaaggaaacctcctttttgctcacattgcaagttcattggccacactattcaacaatgtaagaagattggagcagctcatgtgcctgaag |
21851738 |
T |
|
| Q |
216 |
gcttagacttgggatggaagaagcctcacgctgccaatcaggttcatcataagtagattgttaataacgttcctgaagctcatctgctaaataaacacac |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21851737 |
gcttagacttgggatggaagaagcctcacgccgccaagcaggttcatcataagtagattgttaataacgttcctgaagctcatctgctaaataaacacac |
21851638 |
T |
|
| Q |
316 |
tcactcgcagtttactaacaaaacataacctaatacctggtcaggtaatactttgcttcccaggaactctcagactcaacctttg |
400 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21851637 |
tcactcgcaggctactaacaaaacataacctaatacctggtcaggtaatattttgcttcccaggaactctcagactcaacctttg |
21851553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University