View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15038_low_39 (Length: 268)
Name: NF15038_low_39
Description: NF15038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15038_low_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 88 - 251
Target Start/End: Complemental strand, 32062634 - 32062471
Alignment:
| Q |
88 |
taaggtaaacggtgttattattatggattatgaatgaaacaataataatgagtatgcatgcattttgcacaatctttatctctatgcgtgcgtgtattgt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32062634 |
taaggtaaacggtgttattattatggattatgaatgaaacaataataatgagtatgcatgcattttgcacaatctttatctctatgcgtgcgtgtattgt |
32062535 |
T |
|
| Q |
188 |
gtttgtatgttatatatgcattttgcatgcactatctctttctctctctataaaccctttctct |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32062534 |
gtttgtatgttatatatgcattttgcatgcactatctctttctctctctataaaccctttctct |
32062471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 32062717 - 32062673
Alignment:
| Q |
5 |
gagtcaacctagaaaagcagtagaaacaggtaaggtttttatgtt |
49 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32062717 |
gagtcaacctagaaaaccagtagaaacaggtaaggtttttatgtt |
32062673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University